            Adele (Waiwarapa Wanderer) has unearthed some more Carterton early settler history.
            Jan seasons her genealogy with salt and pepper to explain DNA testing
            Wayne has prepared a genealogical wedding gift.
            St Johns Church, Matarawa, will be celebrating its 150th anniversary in April with a commemorative service and a lunch.

Peter has reviewed three books for us: -
            Both Sides of the River, by Olive Harris
            The Road to Little Dribbling by Bill Bryson
            Panguru and the City Kainga Tahi, Kainga Rua by Melissa Matutina Williams

As usual, we’re always looking for contributions! If you can help in any way, I’d love to hear from you.

And also: if you think that FamNet is worthwhile, tell your friends. Especially if you’re involved with a genealogy group, local history society, or any other group of people with an interest in New Zealand history. FamNet and your group have common interests: FamNet can help your group, and your group can increase FamNet’s membership. We should be working together!

Back to the Top

From the Developer

In this issue I’m continuing the series on Telling your Story.

Telling your Story – Merging Trees. Part 2: Adding Records On-Line

The previous article introduced the concept of merged trees, i.e. family tree databases linking records from different authors. One way of creating such trees is by adding records on line. Trees can be linked by linking one of your records to an ancestor or a spouse in somebody else’s database.

The Test family is a small family tree within my database. Here is a chart of it produced by another user: -

Let’s imagine that your database look like this: -

Now, you’ve discovered that your mother’s father is TEST,Father, and there is a record of him in the robertb database. It is actually much easier to link to this record than to copy its information into your own database. Here’s how you do this: -

1. Open a Tree View in your database: -

2. Click the [Add] button for your mother’s father: -

3. Don’t enter any details: instead, click the [Link] button. This opens a GDB Search. Enter the search details, and click [Search]

4. Select the record that we want to link to – in this case the first record. The Tree View re-appears, but now your grandfather and great grandparents are shown: -

The ownership. (robertb), of the linked records is identified, and you can’t edit them. However they are now part of your family tree. You didn’t need the permission of the other record owner for this, although it’s good manners to contact them. In their record the new line of descent will normally be shown unless it duplicates a record already present, and a control appears allowing viewers to choose whether to hide the “foreign record” by showing only records with the same record owner (robertb), or show them even if when they duplicate other records.

Feel free to experiment by linking your records to my TEST family (but not to real records unless it’s a real link). To remove unwanted links if you make a mistake (or have finished playing) use the Family tab of the Edit view.

In the next article in this series I’ll look at merging trees by combining databases that already exist. A new issue will be: what do we do about duplicate records?

Telling your story. Index so far

So far I’ve covered these topics.

1. Writing your story as notes, or with Word. Embedding links in Word documents.

2. Embedding pictures in Word documents.

3. Saving Documents for Web Publication.

4. Saving Scrapbook Items

5. Sharing your Story: Managing your Family Group

6. On Line Editing: More Facts, Family, GDB Links

7. Comparing and Synchronising Records

8. Producing and Using Charts

9. Merging Trees. Part 1: Why Bother?

Back to the Top

The Nash Rambler

Confession time - I think I have a problem. I may need to talk to a therapist. I need to take a good look at myself and exercise some self control. Let me explain myself.

We have all met a mad genealogist. These specimens are dominated by the art of genealogy. They cannot talk about anything else. They cannot walk past a museum, cemetery, monument, second-hand bookshop or such like without taking a thorough examination of such. They plan their holidays around visits to localities of family history importance or genealogy and/or history conferences. They are boring conversationalists. In fact we can sum it all up by the words "pain in the arse". (Apologies available if required)

For years I have always denied that I was a raving mad genealogist. I knew that genealogy was a hobby; it was something I did when I had nothing else to do. I had it under control. BUT, in the last two months I have done some silly things that are making me realise that maybe I AM a stark raving mad genealogist.

Consider the evidence:

1) Holiday trip to Kerikeri.

In January, my wife and I had a week off work. After much discussion we decided, or should I say I convinced her, that we should take a leisurely drive north for a day or two and Kerikeri was a good place to stop for a night or two. It was a pleasant two days - brilliant weather, brilliant food, very little traffic etc. We stopped at a few places on the journey including Whangarei (where I brought two books at the Piggery - a very good second hand bookshop). Lo and behold there was a bookshop at Waipapa where I purchased a copy of Olive Harris' new book, "Both sides of the river". This book is a collection of articles by various people on their memories of Hokianga and their family. You can understand my pleasure at finding this book.

Real reason: I knew that Olive Harris' new book was recently published and the only place I could buy it, according to Google, was from Village Books in Waipapa. The purchases in Whangarei were a happy coincidence.

2) Puhoi Family Day.

My son came home from London for Xmas. My sister and I decided that instead of our traditional New Year's Day barbeque we would have a family day at Puhoi - lunch at the cheese factory and afternoon tea at the famous pub. As you are probably aware, one of my ancestral lines came into Puhoi on the first boat. So four carloads of family met at the cheese factory and proceeded to have a brilliant day out. Because I no longer drink the sorts of tea the others were enjoying at the world famous Puhoi pub I wandered off to look at a monument and returned about an hour later with two books I bought at the research centre at the museum.

Real reason: I have been trying to get to Puhoi for some time to buy the reproduction of the 1934 thesis on the settlement of Puhoi by Ruth Schmidt (reviewed last newsletter).

3) Trip to Europe:

We have decided to go to London this year to see two of my children who have been living in London for some years. This would be our first big trip together and is very special. I have refused, graciously and with thanks, to take time in England to do some research, particularly in London. I have no particular places I want to go to and am quite happy with the suggestions that came up in the initial planning stages.

My wife and I read Iain Banks' book "Raw Spirit" when it was first released in 2003. It is about a rambling tour of Scottish (don't say Scotch) distilleries, where the distinctive produce (you can say Scotch now) from such establishments were sampled and includes the general banter that arose from such exercise. Since then we have both dreamt about doing something similar - although the banter would be less intelligent than in that book. After some research (good old Google) I found that a whiskey trail exists in Huntly in Aberdeenshire and suggested that a week up there would achieve our ambition. It is being seriously considered.

Real reason: My ARCHIBALD, MENZIES and COUTTS ancestors come from that area. So every churchyard and museum etc will be examined.

4) Trip to Europe II:

For our mighty visitation to Europe I suggested a few days to be spent in Lincolnshire. In particular I suggested we spend a few days in the Louth area and Lincoln city itself. This part is about 150 miles from London and, apparently, except for Skegness, is a really nice part of a forgotten and "off the tourist route" part of England with many historic market towns and Lincoln, itself, which has many old, historic buildings and churches etc.

Real reason: My DINNISS (and variants), SMITH, BLADES and COULHAMS (and variants) come from this area, particularly Anderby, Saleby, Alford, Great Carlton, Louth and Cockerington (both North and South). Many churches, museums and archives (at Lincoln) to visit.

5) Trip to Europe 111:

We have some spare time to spend in Europe and suggestions were made that maybe we should go to Belgium. I knew that my wife had a desire to go to see Bruges so I suggested we go and include Ghent and Antwerp and other areas that might be interesting.

Real reason: Of course Menin Gate is close by and, of course, the grave of my grandfather's brother is very close to Menin Gate. Other relatives are buried nearby.

6) Waikumete Cemetery:

One Sunday, my wife decides that she is going to do nothing and she meant it. She suggested that I disappear for a bit - and I did. Where did I go - well, a cemetery, of course. I found a small notice in the local newspaper about a guided tour of Waikumete Cemetery visiting the graves of some hanged men and their victims among other graves of note. It was almost compulsory that I attend and what an enjoyable few hours spent in the glorious sunshine. I gained some ideas on how to improve my Hillsborough cemetery guided tour I do every October.

7) My father: My father is in his nineties and lives in a Rest Home. His short term memory has gone but his long term memory is still very good. Lately he has gone through a very bad patch of health whereby he doesn't know where he is and what is what. It makes visits very difficult but I have found a way that benefits us both. I ask him about a particular member of his family ie his uncles, grandparents, etc. He will talk for hours on them. He relaxes quite a lot in the process. I have learnt so much the last week or two. I have been able to prove much of what he talks about. But it is not only the facts that are good but it is the day to day memories that he has of each individual that is particularly good for my family history opus that I AM going to write.

I found a comment or two in Olive Harris's book that my father elaborated on. Without the input from both sources I would have missed some vital information about my ARCHIBALD ancestors.

I am extremely guilty about this "interrogation" that I am performing but it seems to relax him a little - but maybe I should be concentrating on him not his relatives.

Considering that all the above has happened in the last six weeks, I am getting worried. Does this lead to further idiocy?

I have decided that I am a mad genealogist. I have decided that I will wallow in this "affliction" and enjoy all its idiosyncrasies. I shall try to avoid too many manipulations of family in such a short time. But, what the hell, I am an old decrepit man who should be allowed some bad habits or behaviour.

Peter Nash

PANash@xtra.co.nz

Back to the Top

DNA Testing for Family History

18. DNA Testing – Starting a new series on Y DNA testing

Ladies, unless you have a male test for you as your proxy for the Y DNA results (or are trying to sweet-talk a male into testing for you – your father, your brother, your father’s brother) – feel free to ignore this article.

If you need to refresh your knowledge regarding Y testing with FTDNA, go to the articles in the Newsletter on Y testing: -

5. Direct paternal line (men only).

8. Understanding direct paternal results.

12. Bits ‘n Bobs: DNA Testing Companies, Glossary.

You will need these and the glossary for a refresher. You may also wish to refresh what a Y test can divulge for you by looking at this simplistic video http://learn.genetics.utah.edu/content/chromosomes/typesy/

In my articles in past newsletters: when referring to your Y Chromosome (male sex chromosome) I have written about the STR results and the values given to the repeats of nucleotide (A,C,G,T) series. I did not get into this aspect of the importance of these nucleotides and I now need to go a little deeper in background information before I introduce a new aspect of Y DNA testing to you. Please note that I shall be referring ONLY to the Y chromosome and ignoring the other 44 chromosomes. For genealogy purposes the Y chromosome for the paternal family is a most important test for any male to take.

If you go to any surname project with Family Tree DNA and pull up the Y DNA chart you’ll see something like this, which is a small snippet from the public Classic Y DNA results page of the New Zealand Provincial DNA project.

Across the top you will see column headings such as DYS393, DYS390, DYS19 and so on. So what does all this mean?

DYS means DNA on the Y chromosome and is reporting the Series of nucleotide repeats. These DYS values are known as STRs or Short Tandem Repeats which means a value of these repeats is reported at that very specific position. The first man’s value at DYS393 is 14: this means that at position 393 on his Y chromosome he had a sequence of 14 repeats of a sequence such as AGAT. For example, the nucleotide sequence might be: - CTGGTCTTCTACTTGTCAATAC/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/ATGTATGTCTTTTCTATGAGACATACCTCATTTTTTGGACTTGAGTTC.

Click this link if you want to know what a nucleotide is: for this article all you need to know is that DNA consists of a sequence of 4 different nucleotides, called adenine, cytosine, guanine, thymine, and represented by the letters A, C, G, and T.

A series of values like

is called a “Haplotype”, and are the results for a particular person. This is then compared with another man also of the G Haplogroup (in another project – this might be the “G Haplotype” project in FTDNA or in his own surname project). If they are the same or very similar, then we say they are in the same direct paternal male lineage. What we can never say is that other tester’s actual name, nor can we say, without additional computation for this tester and his match, how many generations back the common ancestor is, although we do possess averages.

FTDNA uses “TIP reports”. Personally, I ignore these as they are far too general, but some are forever referring to them – possibly because they have no knowledge as to how to go deeper and actually assess the resulting haplotypes.

Currently, you can order up to 111 of these STRs with FTDNA – known as Y111 – and the more markers tested, the more certain the accuracy of the comparison. (NB: Ancestry does not do such testing and 23andMe gives an indication only).

If the haplotypes are not the same at every marker but differ by say 1 value, then we know a “mutation” – a random change in the sequence - has occurred at that particular position. The greater the differences (or mutations) at the higher the testing level, the more distant the match. Thus two male testers at Y111 with only one difference could be brothers, a father and son, a great grandfather and grandson or even a GGG grandfather etc. It depends on the volatility of the marker involved. As an example, if the differences are say 4 or 5 at the Y111 level, then the common ancestor could well have lived more than 500 years ago.

Notice too the names of the Haplogroups. These are designated by the discovery of a SNP on the Y chromosome. In the first line is a gentleman with a G Haplogroup and his tested SNP is CTS4803. The next group is the I haplogroup, designated by the SNP M253. The green one is a confirmed and tested SNP and the red one is predicted only. The same applies to all the other Haplogroups. This is a point you will need to consider multiple times. I have lost count of the number of times a member asks me as to how come his cousin has a different haplogroup as he has. The answer is invariably along the lines of “he has tested a particular SNP and you have not (or vice versa)”.

As well as STRs there is another important aspect of the Y chromosome, colloquially termed SNPs (pronounced SNiPs). SNP is an abbreviation of Single Nucleotide Polymorphism. These SNPs operate on exactly the same principle as described above, but there is a differing method of analysis and the reported SNPs are not as volatile as those for the STRs. Generally, to distinguish, we style the DYS results as ‘markers’ whereas now we are dealing with the ‘true’ SNPs.

Going back a step, you do know that there are two strands to the Y chromosome, don’t you? Yes, of course you do – this is the “double helix”. In between those dual strands are the nucleotides A, C, G, T.

There is an expectation that at a given position on the Y chromosome in a particular Haplogroup will be say AT or GC, i.e. if the nucleotide on one strand is an A then the nucleotide at the same position on the other strand will be T. These two pairs are naturally aligned together because of the rules of chemistry. BUT, sometimes there is a hiccup at or after conception and there is a change from an expected result to something else. In this example graphic (taken from Wikipedia), we read

“…at a specific base position in the human genome, the base C may appear in most individuals, but in a minority of individuals the position is occupied by base A. There is an SNP at this specific base position, and the two possible nucleotide variations - C or A - are said to be alleles for this base position. …”

Generally this change is continued through the generations of a particular family and becomes immensely important in both calculating the ethnicity of the tester’s Haplogroup as well as designating the particular family. And now we are getting into a ‘state of the art’ genetics. These SNPs are of great importance to both scientists and genealogists and in recent time, even the medical fraternity have come to realise the importance of the role that these SNPs play in terms of our physical and genetic strengths and weaknesses. But I digress.

This hopefully gives you the necessary background to be able to cope with the forthcoming articles on SNP testing.

Remember that I am dealing in these articles only with the Y chromosome and not going near either the autosomal mutations found in chromosomes 1-22 nor the X chromosome. Nor am I a biologist.

As always, if you have any questions, please click on this link and contact me directly

Index so far

This is a complete list of the articles written by Gail over the last year or so.

Just click the link to go back to a previous article in this series.

1. What is Molecular Genealogy?

2. Where would I begin?

3. What test should I take?

4. What DNA will NOT tell you and the risks involved.

5. Direct paternal line (men only).

6. Direct maternal line (men and women).

7. All the lineages including maternal and paternal (men and women).

8. Understanding direct paternal results.

9. Understanding direct maternal line results.

10. Understanding your Autosomal ("cousin") results.

11. Understanding the X Chromosome.

12. Bits ‘n Bobs: DNA Testing Companies, Glossary.

13. DNA Websites, Blogs, and Forums

14. Commonly Asked Questions – Some Basic, Some Advanced

15. DNA – Something a little different…

16. Current Pricings for the Three Main Genealogical Testing Firms

17. DNA Testing for Family History

Gail Riddell

News and Views

We invite contributions from FamNet members for this section: please contact The Editor if you have any material. Contributions received after the 22nd of each month may be carried forward.

Wairarapa Wandering. Wm TOOMATH

This lovely old postcard is of High Street Carterton about 1900s. I was after the view as I hadn’t seen Toomath on a shop previously, and I had to learn more - where did they come from, and anything I could find out about the family – as part of my research into early Settlers to Carterton District. Sadly I couldn’t purchase this postcard, so did the next best thing, had it copied.

I have since found out from the grandson of Wm. Toomath more of the history, and passed it on to Carterton District Historical Society in person. Wm. Toomath's wife had the business, a bookseller. In fact in the last 100 years this plot has had a book shop there since, but that’s due to change shortly. The tall buildings would have come down in the 1940s earthquake, as today we have Take Note there, in a small building.. There is mention in A History of Carterton, of a W. Toomath being with the newly founded Carterton Scout movement, this would be around 1908. When I asked the Scout Historian, Owen Rodgers, he said not heard of the name, so I let him have what the family had sent me. The following is taken from an autobiography from the Toomath family: -

"Two Fairbrother brothers, Merv and Pat, lived in a large house with a barn attached. About 1907 Major Gen Baden Powell, hero of the Relief of Mafeking in the South African War, conceived the idea of forming an organisation for boys as a medium of training for future citizenship and these two brothers, Merv and Pat decided to form a Scout Troop and have meetings in the barn. A local sawmill, Rathbone's Admiral sawmill near Martinborough had camps there."

The Toomath family first lived in nearby Greytown before coming to Carterton, William is also mentioned with Carterton Council as a Councillor, he was also employed by the P & A Society which in the early 1900s was down Belvedere Road, Carterton, but in 1970s moved to Clareville. The family moved on up to Gisborne, as that address is listed with his son’s enlistment papers for WW1. William was also listed as an Auctioneer and Teacher at Carterton, they moved 1910. There is a large grave at Bolton Street Cemetery for the Toomath Family, thanks to Nick Perrin for this information. The Toomath family came out from Fermanagah. Ireland, and also built in Ghuznee Street in Wellington, and Masterton. Large brick buildings, the one in Wellington may possibly still be there.

By having a photograph/post card of how the buildings were over 100 years ago, it’s wonderful to see its history, then to see the businesses today, so different. I enjoy learning about history in my chosen country of New Zealand.

Adele Pentony-Graham
Carterton Early Settlers Researcher.

Jan’s Jottings

Seasoning your genealogy

Where were you on Tues 15 March around 12.30pm? If you were in the Coffee Shop in Orewa you would have seen a strange sight!!! A group of ladies, huddled around numerous tables, watching one of their number moving numerous salt and pepper shakers around in some prehistoric ritual - well, that’s what it looked like anyway!!!!

Who were these people? Genealogists! What were they doing there? Having lunch prior to the monthly meeting of the Hibiscus Coast Branch of the NZSG. But what were they doing with the salt and pepper shakers?

Explaining DNA of course! Jan pinched the shakers from numerous tables. The pepper shakers were the Y (male) chromosome. The salt shakers the Mt (female) chromosomes.

Jan placed the pepper shakers in a backwards forming line to the edge of the table. These were the males, giving their Y chromosome to succeeding males each generation.

The female salt shakers were placed in a matching line across from the males. Passing their Mt chromosomes down the generations of females. She did not attempt to show that this was also passed to the sons in each generation but stopped there.

Then, in the middle on the front of the table were grouped the remaining shakers, both pepper and salt, to signify the autosomal chromosomes - where we are, not only a mix of Y and Mt but also numerous other chromosomes. [Where were the sauce bottles, the mustard, the vinegar bottles?]

Jan likens DNA testing to clicking your seat belt. You will never know how many times you have saved your life because you clicked your seatbelt, but you will know for sure that you haven’t if you haven’t when you needed to!! You can never know how much you can find from a Y, or Mt or atDNA test - but, for certain, you won’t find anything if you don’t test.

Having just attended RootsTech in SLC and then the Unlock the Past 18 night cruise, Jan has listened to a large number of lectures this year!! Lots were looking at DNA testing. Strongly coming through was the suggestion to always have an atDNA test along with the Y and the Mt. Aim for no less than the 67 marker Y DNA test, but the 111 if you can afford this. Also the suggestion that you should have, at least the atDNA test, with more than one provider. (Ancestry and FamilyTreeDNA for instance).

We heard lots of SUPER DNA stories! And some sad. Ask Jan to tell you about them next time you meet.

Jan

A Wedding Present

In April my wife and I are off to a wedding of a nephew. Anthea thought something along genealogical lines would be nice, so I put together a coffee table publication in full colour, showing an ancestral tree chart with many photos for visual impact. I incorporated pictures of various documents to show things like how some people changed the spelling of their names in their own lifetime, confirmed in documentary records. It is a nice gift to a young couple and will give them a foundation to their family history, now and yet to come. It has been very rewarding to me in more ways than one.

Wayne

St John’s Church, Matarawa 1866-2016

The building in 1866 of St John’s Church at Matarawa, situated on No 2 Line between Durie Hill Wanganui and Fordell, was a proud accomplishment for the thriving but still new settler community. Maps and electoral rolls referred to this area as the Left Bank [of the Wanganui River]. The community referred to it as Matarawa. Fordell township was not to evolve till years later and No 2 Line had no direct roading into Wanganui via Durie Hill. This April, the church is going to celebrate its sesqui and people who have an interest in the church are invited to celebrate its 150 years.

Robert Barnes has often written about his ancestor Hannah Barnes nee Old. The Old family were one of the early settlers of the area and Hannah’s father and sisters were buried in St John’s Churchyard. My great grandmother’s sister Beatrice Robertson married Hannah’s eldest brother John Old. Beatrice and her sister Isabella Robertson belonged to a group of families that arrived in Matarawa mid 1850-60 decade – Howies, Aikens, McWilliams, McIntoshs and settled near No 1 and No 2 line. Gilbert Pearce celebrated their first hundred years with two publications. “The Aiken Family 1852-1952”, and “The Howie Family 1854-1954”, a great achievement in putting these trees together in the days of no internet nor personal computer, when exchanges of information were by snail mail or face to face, using just personal memories. Marie White’s “Lakes District of Wanganui” published first in 1990 and updated in 1997 for me produced the most marvellous discovery. Isy Robertson was listed there in the 1855-68 roll list of Matarawa School. Family tales about her coming to New Zealand as a youngster were now backed up by documentary proof. Though not written till the end of 1868 and into 1869, Nathaniel Sutherland’s diary gives a snapshot of the Matarawa community around the early years of St John’s. Rebecca Lenihan quoted from it in “From Alba to Aotearoa: Profiling New Zealand Scots Migrants” when looking at interconnectedness of families and friendships.

For my part I have had published articles on Isabella Robertson [Mrs Donald Lourie] and Beatrice Robertson [Mrs John Old] in “A Scottish Mother” and Alexander Howie, their grandfather, the patriarch of our New Zealand Howies, in “A Scottish Father”. Both publications were produced by Dunedin Family History Group in 2012. Gail Riddell has provided excellent information on DNA on FamNet and to my delight, two of the first three closest relations to appear on my recent autosomal DNA test were a Lourie [through Isabella] and a Howie[ through Alexander],

For those interested in attending the church service and luncheon on 17th April details are in this attached newsletter. The committee would like all registrations before 31st March.

Bobbie Amyes

From our Libraries and Museums

Triggered by an email from Seonaid (Shona) Lewis, I am offering a forum to our libraries and museums to publicise their events, and to contribute articles to this newsletter that may be of interest to our readers and by publicising what’s available at their library/museum increase their visitor numbers. Let’s see if other libraries and museums take up this offer.

For readers of this newsletter: please bring this to the attention of your local libraries etc, and encourage them to participate.

Auckland Family History Expo

Please put a ring around the dates Friday 12 August through to Sunday 14 August. This is the weekend for the Auckland Family History Expo. Starting with an opening on Friday night through Saturday with lectures and Trade Tables and the same on Sunday. There may even be something on the Saturday night.

This year the event will be held at the Fickling Convention Centre, 547 Mt Albert Rd, Three Kings - free parking and plenty of it!!!

As the event is being held at the Conference Centre underneath the Mt Roskill Library and including the Library, there will be no charge. Though we may just have a handy hat for a gold coin donation!

We plan to have two overseas speakers, one from the US and the other from Australia.

Lots of Exhibitors with lots of goodies. Tables for special genealogical assistance eg Special Interest Groups for countries, for genealogy programs etc.

Maybe an 'Ask the Experts' session upstairs in the Library.

Planning something for new genealogists (please let your NGF know (non genealogical friends) and your GFFAN (genealogical family, friends and neighbors).

For further information or if you came to the Expo last year and would like to comment email AFHE@genealogy.net.nz. Was there something you really appreciated and would like to see again? Something you don't want to see again? Or something you would love to see for the first time?

Don't forget to claim the date in your diary.

Group News

Whangarei Family History Computer Group

Contacts:

Wayne: (09) 437 2881 wayne@bydand.co.nz

Pat: (09) 437 0692 whangareifamilyhistorygroup@gmail.com

Venues

Thursday evening venue is 6 Augusta Place, Whau Valley. Call Wayne or Pat or;

email Whangareifamilyhistorygroup@gmail.com, if you need directions.

Saturday meetings are held in the SeniorNet rooms in James Street.

The rooms are upstairs in the Arcade leading to Orr’s Pharmacy and Tiffany’s Café, Start time 9.30 till finished before 1.30pm.

Waikanae Family History Group

Contacts:

Email: wfhgroup@paradise.net.nz Phone (04) 904 3276, (Hanley Hoffmann)

Venue: Meets every 4^th Thursday morning at the Waikanae Chartered Club, 8 Elizabeth Street Waikanae, just over the Railway Crossing from 9.30am to 12 -12.30pm, every month from January to November. Research days planned for either 2^nd or 3^rd Thursdays at 9.30am approximately four times a year.

Here is Waikanae’s latest newsletter.

Hanley Hoffmann, Waikanae Family History Group.

Back to the Top

Community

Letters to the Editor

The discussion about Family Tree Maker in January’s newsletter prompted Julie to write: -

I have read with interest the comments about Family Tree Maker. I would like to relate an issue that I encountered not too long ago. I had an up-to-date copy of The Master Genealogist when they went to being unsupported (much like I believe FTM are intending), I was in the process of getting all my data ready to transfer to FTM (my choice at the time) when my hard drive died. Despite backups being done I was unable to reload TMG and only able to transfer most (but not all data from TMG to my new updated FTM). Now months on I am in the same position with FTM. I will not make the same mistake and will transfer all my data to a new (yet to be decided which one) family history database. Hope this may be of help or at least be some insight into the issues one reader has had. So beware of staying with FTM when it becomes unsupported.

Julie

Thanks for these comments Julie. It sounds as if you were particularly unlucky, with your hard disk failing and being unable to fully recover the data from backups. I suspect that you would have had this problem if the hard disk had failed earlier, while TMG was still supported, as the fault may not have been in the TMG program itself, but in your individual TMG database. A key lesson from this to everybody: you should check your backups from time to time, ensuring that you can recover from them.

Your warning about the risks of using unsupported software are valid. There might be no problem. Recently I moved FamNet to Amazon Web Services because it was using an operating system (Windows Small Business Server 2003) that was becoming unsupported. In the process I discovered that our actual database, SQL Server 2005, was already unsupported and had been so for a couple of years: the current version is SQL Server 2015. Fortunately there had been absolutely no problems, but I'm pleased that everything is now running on the latest software, all fully supported. So while you might use unsupported software for a long time without a problem, if you do strike problems you can be on your own. The "No panic" message is correct, but it is also correct that FTM users had best think of another long term solution.

Going forward, I think that everybody needs to have their local database, plus a web copy. If their database is a collection of Word and Excel documents then they should use a cloud service such as Dropbox to keep an external copy. If they use a genealogy database (FTM, Legacy, etc) then their web copy could be Dropbox if they simply want a backup, but if they want to share the data and make contact with others researching their names they should use a genealogy web site. Naturally I recommend FamNet for the genealogy web site.

For readers wanting to get a local database program I suggest they talk to Jan Gow, who will probably recommend Legacy.

Information Wanted/Offered.

Remember that you can post photos for identification, and information wanted requests:-

Click here to post a photo

Click here to request help with some information

We’ll post the photos and information requests in the next newsletter, and they’ll remain on display for at least a year.

We have nothing new for this issue.

Back to the Top

Book Reviews

Both Sides of the River, by Olive Harris

Published 2015, self published, ISBN 978-0-473-31687-7,

This book is available from Village Books, 12 Klinac Lane, Waipapa, Ph 09 4073806, (villagebooks1@gmail.com) which is a lovely second hand bookshop just out of Kerikeri and is well worth a visit if you are in the area and have a few dollars in your pocket.

Olive Harris has a knack for getting people to write their memoirs of their life in the Hokianga area or getting permission to publish diaries, articles and memoirs of early settlers. This is the third in a series of such books in which she has dug up all sorts of stories which come from both North and South Hokianga. She, with Editor Chris Lancaster, self publish her books which makes them hard to acquire because they do not appear in the chains of bookseller stores.

This book is a collection of wonderful memories of ordinary settlers in Hokianga. Individually, each memory is too short or unpolished to make a book of their own and thus would not get published and thus would get lost when the owners pass on. Olive has preserved so many small articles that, together, paint a vivid picture of hard life was in early Hokianga.

Olive Harris has done Hokianga a great service by publishing her books.

If you have any connection to Hokianga, it is well worth purchasing these books.

Peter Nash

The Road to Little Dribbling by Bill Bryson

Published 2015 by Doubleday, an imprint of Transworld Publishers, which is part of Penguin Random House, ISBN 978-0-857-52234-4 (available at Whitcoulls)

Twenty years Bill Bryson travelled throughout Britain and consequently wrote the hilarious and very popular book, "Notes from a Small Island". This was one of many such travel books in which he focussed on countries like USA, Australia & Britain and explored the funny, idiosyncratic nature of the people he met and places he went.

This book is a return, twenty years later, to Britain to see whether anything has changed.

Bryson did not revisit the places he had previously visited but followed, roughly, a line he created and named "the Bryson Line" from Bognor Regis to Cape Wrath, in Scotland. To quote the cover -" .... by way of places that many people never get to at all, Bryson sets out to rediscover the wondrously beautiful, magnificently eccentric, endearingly unique country that he thought he knew but doesn't altogether recognise any more."

Although he appears to be more cynical and impatient the older he gets, this book is a very easy and enjoyable read and hard to put down. I was annoyed when I reached the end because of the pleasure I got from it.

Not really a book of genealogy interest but one well worth reading. I recommend it as an enjoyable read.

Peter Nash

Panguru and the City Kainga Tahi, Kainga Rua by Melissa Matutina Williams

Published 2015 by Bridget Williams Books, ISBN 978-1-927247-92-1 (available from the publisher's website)

To quote the cover:-

"travelling from Hokianga to Auckland in the middle decades of the twentieth century, the people of Panguru established themselves in the workplaces, suburbs, churches and school of the city."

Melissa Matutina Williams, a daughter of such migration, writes a scholarly book incorporating oral narratives from the migrants from a back-of- beyond, north Hokianga district to the big city.

As you are probably aware, my family comes from the Hokianga, from the Kohukohu area - just round the corner of the Hokianga Harbour from Panguru (but do not try to walk that road). My parents and their siblings and cousins followed the same process in their migration to Auckland. There seemed to be very little difference between the experiences of Maori from Panguru and my relatives - although mine were not as interested in the church side of life. I was told similar stories by my relatives when I interviewed them in the early 1990's for a family reunion book produced. This author is far more skilled than I am in telling the stories of the migration.

Similar migrations took place all over New Zealand, whether Maori, pakeha or islanders. This book is the first I have read that tries to put down in words the experiences of these internal migrants.

A very scholarly book but essential reading if you want to get an understanding of the internal migration from backblocks or small town New Zealand to the big city. If you are writing your own family history this book is probably a "must read".

Peter Nash

In conclusion

A Bit of Light Relief

-Genealogist

Advertising with FamNet

As of January 2014 if your organisation is not a group subscriber then there will be a charge for advertising events and services, which must be paid for before publication. Charges start at $NZ25 for a basic flier, and increase for more elaborate presentations. FamNet is a charitable organisation and like everyone else we need funds to help keep FamNet going. Fees are very minimal. If your organisation paid a yearly subscription you can have all the advertising you want all year round in the Group News section. Your group could be anywhere in the world, not just in New Zealand. The editor will continue to exercise discretion for free events.

To Unsubscribe, Change your Email Address, or Manage your Personal Information

If you have problems with this page you can email us directly but hopefully the page is self-explanatory.

Copyright (Waiver)

Feel free to redistribute this newsletter. If you publish a newsletter yourself you may include material from this newsletter in yours provided that you acknowledge its source and include the FamNet URL, www.famnet.org.nz

Back to the Top